MFOLD prediction result interpretation

We are searching data for your request:

Forums and discussions:

Manuals and reference books:

Data from registers:

Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I am trying to predict the secondary structure of certain predicted pre-miRNAs through mFOLD which is the generally accepted technique for structure prediction in most studies. I am finding it hard to interpret the result and accept if the pre-miRNA which I have picked and the miRNA I have can be accepted and included in my result.

This is one predicted pre-miRNA structure with the predicted miRNA position shown in green.

Is this a good/bad structure and if so, can anyone give me a reason why. Thank you.

edit: I understand that energy levels are also something that is looked for in the prediction. In this particular figure, ΔG = -75.00 kcal/mol which I think is fine.

Sequence used for folding is

AAAAATAAAAAACAGAACCATGAGGCAGCGCACCAAGAGCGTCGTGAACGTCCGCGAATA CTTCCGCATGGACGGCAGTGGCGCCCCCGAGCAGGAGGACGACGATGACAACGATGACTG GATGGCCATCGCCATGCAGGGCGCACCGCGTAAGGTCAGCGTGGAAGTCGTTAAGCCTGG CAAGAAGGCACGCGCTCGTACGTCGACGTGTGACTCAC

and the highlighted match area is

ACGATGACAACGATGAC

So this structure should be fine because the sequence lies along a stem-loop structure.

I am worried about that bulge on the left top corner though. That doesn't affect the predictability of this structure does it?

The green region will definitely not make an miRNA: It is not a part of a stem loop. See typical miRNA structures from miRbase.

EDIT

Bulges can sometimes determine which strand is chosen as mature miRNA. However, this green region is also is unlikely to form miRNA because the stem is just 15bp.